ESPE2018 Poster Presentations Diabetes & Insulin P1 (53 abstracts)
CpG Methylation Status Changes within the Protein Tyrosine Phosphatase Non-Receptor Type 22 Gene Promoters in Children and Adolescents of Greek Origin with Type 1 Diabetes
Konstantina Mouzaki a , Styliani Giza a , Eleni P. Kotanidou a , Aikaterini Fragou b , Maria Taousani b , Maria Eboriadou-Petikopoulou a , Georgios Tzimagiorgis b & Assimina Galli-Tsinopoulou a
a4th Department of Pediatrics, School of Medicine, Faculty of Health Sciences, Aristotle University of Thessaloniki, Papageorgiou General Hospital, Thessaloniki, Greece; bLaboratory of Biological Chemistry, School of Medicine, Faculty of Health Sciences, Aristotle University of Thessaloniki, Thessaloniki, Greece
Introduction: Protein tyrosine phosphatase non-receptor type 22 (PTPN22) is a well-established genetic locus of type 1 diabetes (T1D). The aim of the present study is to compare the methylation level of PTPN22 between children and adolescents of Greek origin with T1D and healthy controls.
Patients and Methods: Twenty T1D participants and 20 age-/gender-matched healthy youngsters were enrolled. DNA was extracted from white blood cells, then treated with sodium bisulphate which converts unmethylated cytosines into uracyls, whereas methylated cytosines remain unchanged under the same conditions. DNA was then amplified by PCR using primers:(F) primer:5′TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTTTTGGTTTATGTTGTAGAGT3′ and (R) primer:5′GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTTACATATAAATAATA AAATAAAAT3′. Amplicons were analysed by electrophoresis (1% agarose gel stained with ethidium bromide), visualized by ultraviolet trans-illumination, and then Next Generation Sequencing was applied to identify differences in DNA methylation status. The methylation profile was analyzed at 4 CpG sites of the PTPN22 gene. Comparisons between groups were performed with student’s t-test or its non-parametric analogue, Mann Whitney U test, as appropriate.
Results: We found that the methylation level was statistically significant lower at position 1-4826 (P=0.026) in patients (0.35±0.17) compared to controls (0.52±0.28). Furthermore, there was a tendency for statistically significant hypomethylation at position 3-5018 (P=0.065) in patients (0.24±0.09) than in controls (0.30±0.13).
| DNA methylation (%) T1D (n=20) | Controls (n=20) | p | |||||||
| Overall mean methylation percentage | |||||||||
| Mean methylation | 0.4±0.1 | 0.46±0.14 | 0.179 | ||||||
| Range | 0–1 | 0–1 | |||||||
| CpG sites | |||||||||
| 1-4826 | 0.35±0.17 | 0.52±0.28 | 0.026 | ||||||
| 2-4950 | 0.45±0.22 | 0.51±0.29 | 0.640 | ||||||
| 3-5018 | 0.24±0.09 | 0.30±0.13 | 0.065 | ||||||
| 4-5046 | 0.56±0.37 | 0.50±0.34 | 0.659 | ||||||
| Results are expressed as Mean ± Standard Deviation. | |||||||||
Conclusion: To our knowledge, this is the first time to detect hypomethylation of PTPN22 gene in patients with T1DM.
Article tools
My recent searches
My recently viewed abstracts
Authors
ESPE Abstracts
© Bioscientifica 2024 |
Privacy policy |
Cookie settings
BiosciAbstracts
Bioscientifica Abstracts is the gateway to a series of products that provide a permanent, citable record of abstracts for biomedical and life science conferences.
Find out more