ESPE2018 Rapid Free Communications Diabetes and Insulin 2 (6 abstracts)
Insulin Gene Promoter Methylation Status in Greek Children and Adolescents with Type 1 Diabetes
Konstantina Mouzaki a , Eleni P Kotanidou b , Aikaterini Fragou c , Styliani Giza a , Angeliki N Kleisarchaki a , Vasiliki Rengina Tsinopoulou a , Anastasios Serbis a , Georgios Tzimagiorgis c & Assimina Galli-Tsinopoulou a
a4th Department of Pediatrics, School of Medicine, Faculty of Health Sciences, Aristotle University of Thessaloniki, Papageorgiou General Hospital, Thessaloniki, Greece; b4th Department of Pediatrics, School of Medicine, Faculty of Health Sciences, Aristotle University of Thessaloniki, Papageorgiou General Hospital Thessaloniki, Greece, Thessaloniki, Greece; cLaboratory of Biological Chemistry, School of Medicine, Faculty of Health Sciences, Aristotle University of Thessaloniki, Thessaloniki, Greece
Introduction: Insulin (INS) gene is reported to be the most important gene involved in Type 1 Diabetes (T1D); its expression is inversely correlated with methylation at CpG sites. Hypermethylated primers are associated with decreased expression.
Aim: The present study aims to investigate possible differences in DNA methylation pattern between T1D youngsters and healthy controls.
Patients and Methods: Twenty T1D participants and 20 age-/gender-matched youngsters without T1D were enrolled. DNA was extracted from white blood cells, then treated with sodium bisulphate which converts unmethylated cytosines into uracyls, whereas methylated cytosines remain unchanged under the same conditions. DNA was then amplified by PCR using primers: (F) primer: 5′ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTA TTTTGGAATTTTGAGTTTATT 3′ and (R) primer:5′ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGAACAAAAATCTAAAAACAA CAA 3′. Amplicons were analyzed by electrophoresis (1% agarose gel stained with ethidium bromide), visualized by ultraviolet trans-illumination, and then Next Generation Sequencing was applied to identify differences in DNA methylation status. The methylation profile was analyzed at 10 CpG sites of the INS gene. Comparisons between groups were performed with student’s t-test or its non-parametric analogue, Mann Whitney U test, as appropriate.
Results: The results are described in table. The overall mean methylation percentage in the T1D patients did not differ compared to healthy controls. A statistically significant difference in INS gene between the two groups concerning the methylation at position 2-4553 (P=0.046) was detected, while a trend (P=0.06) at position 7-4796 was observed.
| DNA methylation (%) | |||
| 10 CpGs in INS gene | T1D (n=20) | Control group (n=20) | P |
| Overall mean methylation percentage | |||
| Mean methylation | 84.13±3.6 | 82.28±2.8 | 0.0848 |
| Range | 77–92 | 76–87 | |
| CpG sites | |||
| 2-4553 | 96.32±2.2 | 93.28±4.5 | 0.02 |
| 1-4541 | 94.00±5 | 90.78±7.9 | 0.15 |
| 3-4664 | 91.02±6.3 | 89.58±8.4 | 0.65 |
| 4-4692 | 63.16±8.9 | 62.30±9.8 | 0.86 |
| 5-4718 | 85.78±6.6 | 84.35±9.9 | 0.82 |
| 6-4763 | 56.65±9.8 | 52.82±1 | 0.25 |
| 7-4796 | 90.01±3.6 | 86.53±6 | 0.06 |
| 8-4829 | 80.28±6.2 | 77.72±8.4 | 0.32 |
| 9-4879 | 91.51±5.2 | 89.05±9.2 | 0.67 |
| 10-4960 | 96.37±2.7 | 97.91±1.3 | 0.10 |
| Results are expressed as Mean ± Standard Deviation. | |||
Conclusions: These preliminary data suggest a tendency for increased methylation in INS gene promoter already existing in childhood T1D. Alterations within INS gene promoter sites could serve as a biomarker for early detection of predisposed to T1D children. Further investigation needs to confirm these findings.
Article tools
My recent searches
My recently viewed abstracts
Authors
ESPE Abstracts
© Bioscientifica 2024 |
Privacy policy |
Cookie settings
BiosciAbstracts
Bioscientifica Abstracts is the gateway to a series of products that provide a permanent, citable record of abstracts for biomedical and life science conferences.
Find out more