ESPE2018 Poster Presentations Diabetes & Insulin P2 (63 abstracts)
HLA-G Gene Promoter Methylation Status in Children and Adolescents with Type 1 Diabetes
Konstantina Mouzaki a , Eleni P Kotanidou a , Aikaterini Fragou b , Styliani Giza a , Maria Taousani b , Anastasios Serbis a , Maria Eboriadou-Petikopoulou a , Georgios Tzimagiorgis b & Assimina Galli-Tsinopoulou a
a4th Department of Pediatrics, School of Medicine, Faculty of Health Sciences, Aristotle University of Thessaloniki, Papageorgiou General Hospital, Thessaloniki, Greece; bLaboratory of Biological Chemistry, School of Medicine, Faculty of Health Sciences, Aristotle University of Thessaloniki, Thessaloniki, Greece
Introduction: HLA-G gene is involved in the control of immune response. It plays a primary role on immune tolerance and may participate in controlling autoimmune responses serving as a potential independent susceptibility marker. HLA-G has been isolated in some secretory granules and on the cell surface of primary islet cells induced to secrete insulin. Subsequently, it could be hypothesized that HLA-G methylation at pancreatic islet could sustain T cell activation and onset of diabetes. To the best of our knowledge the methylation of HLA-G gene promoter has not been studied yet in T1D. We aimed to investigate the methylation patterns of HLA-G CpG loci in T1D paediatric population.
Patients and methods: Twenty T1D participants and 20 age-/gender-matched healthy youngsters were enrolled. DNA was extracted from white blood cells, then treated with sodium bisulphate which converts unmethylated cytosines into uracyls, whereas methylated cytosines remain unchanged under the same conditions. DNA was then amplified by PCR using primers:(F)primer:5’TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTAGGGAGTTTAGTTTAGGGAT3’ and (R)primer:5’GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCCATAACCACCATCCTTAA3’. Amplicons were analyzed by electrophoresis (1% agarose gel stained with ethidium bromide), visualized by ultraviolet trans-illumination, and then Next Generation Sequencing was applied to identify differences in DNA methylation status. The methylation profile was analyzed at 19 CpG sites of the HLA-G gene (1-5446,2-5484,3-5550,4-5568,5-5579, 6-5599, 7-5629, 8-5652, 9-5654, 10-5690, 11-5715, 12-5719, 13-5772, 14-5775, 15-5778, 16-5780, 17-5801, 18-5813,19-5832). Comparisons between groups were performed with student’s t-test or its non-parametric analogue, Mann Whitney U test, as appropriate.
Results: The results are described in table. HLA-G gene did not exhibit significant differences regarding the methylation status within its promoter sites compared to healthy individuals.
| 19 CpGs in HLA-G gene | T1D (n=20) | Controls (n=20) | P |
| Mean methylation | 42.99±5.23 | 43.94±4.31 | 0.602 |
| Range | 36–51 | 37–52 | |
| Results are expressed as Mean±S.D. | |||
Conclusions: Despite the described close association of HLA-G with autoimmunity, we failed to find any methylation differences in HLA-G promoter sites between T1D patients and controls.
Article tools
My recent searches
My recently viewed abstracts
Authors
ESPE Abstracts
© Bioscientifica 2024 |
Privacy policy |
Cookie settings
BiosciAbstracts
Bioscientifica Abstracts is the gateway to a series of products that provide a permanent, citable record of abstracts for biomedical and life science conferences.
Find out more