ESPE2018 Poster Presentations Growth & Syndromes P3 (51 abstracts)
A Novel Heterozygous Pathogenic Variant in PORCN Gene Causing Focal Dermal Hypoplasia with Short Stature: Case Report and Literature Review
Di Wu a , Xuyun Hu b, , Xiaoqiao Li a , Liya Wei a , Chang Su a , Jiajia Chen a , Miao Qin a , Chunxiu Gong a & Yiping Shen b,
aDepartment of Endocrinology, Genetics and Metablism, Beijing Children’s Hospital, Capital Medical University, National Center for Children’s Health, Beijing, China; bGenetic and Metabolic Center Laboratory, Maternal and Child Health Hospital of Guanxi Zhuang Autonomous Region, Nanning, Guangxi, China; cShanghai Children’s Medical Center, Shanghai Jiao Tong University School of Medicine, Shanghai, China; dDivision of Genetics and Genomics, Boston Children’s Hospital, Harvard Medical School, Boston, USA
Objective: To explore the clinical features and the genetic cause of a multiple malformation patient with short stature.
Methods: The clinical data was collected in Beijing Children’s Hospital in November 2017. The disease-causing variant was identified using exome sequencing and confirmed with Sanger sequencing. Related literature was searched from Wanfang and Pubmed databases using the key word of ‘PORCN gene’ to identify the clinical features and gene mutation.
Results: The patient is a 10-year-old girl, she was referred to hospital because of short stature. She presented multiple deformities such as patchy skin hypoplasia, syndactyly and right ear malformation. In exon 2 of PORCN gene, genetic sequencing revealed a de novo heterozygous variant c.49_80delTGTCTCCTGCCTACTGCCCAGCAGGGCCTTGA (p.C17fs*84). The variant is novel and classified as pathogenic. The patient was diagnosed with focal dermal hypoplasia (FDH).
Conclusion: FDH is a multi-system affected birth defect. In addition to typical skin damage and bone malformation, it can also cause short stature.
Article tools
My recent searches
My recently viewed abstracts
Authors
ESPE Abstracts
© Bioscientifica 2024 |
Privacy policy |
Cookie settings
BiosciAbstracts
Bioscientifica Abstracts is the gateway to a series of products that provide a permanent, citable record of abstracts for biomedical and life science conferences.
Find out more